Encyclopedia > Shotgun sequencing

  Article Content

Shotgun sequencing

Shotgun sequencing is a method used in genetics for sequencing long DNA strands. The DNA is first cut into small pieces by restriction enzymes. Then the pieces are sequenced individually. By doing this for several copies of the same long DNA strand, overlapping fragments are created. Finally, computer programs align these overlapping sequences and determine the original (long) sequence.

An extremely simplified example with only two sequences is as follows:

 Original strand         : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

 First shotgun sequence  : XXXAGCATGCTGCAG
                                          TCATGCTTAGGCTAXXXX

 Second shotgun sequence :                      TTAGGCTAXXXX
                           XXXAGCATGCTGCAGTCATGC

 Reconstructed strand    : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

In real-world applications, there are thousands or millions of sequences to deal with, with the addition of transcription and sequencing errors. The computational power required to re-align the sequence in real projects is enormous. For the shotgun sequencing of the human genome in the Human Genome Project run by Celera Genomics in 2000, several supercomputers were running some month nonstop to align all human DNA correctly.



All Wikipedia text is available under the terms of the GNU Free Documentation License

 
  Search Encyclopedia

Search over one million articles, find something about almost anything!
 
 
  
  Featured Article
Urethra

... of the body. The urethra has an excretory function in both sexes, to pass urine to the outside, and also a reproductive function in the male, as a passage for sperm. ...

 
 
 
This page was created in 38.5 ms