Encyclopedia > Restriction enzyme

  Article Content

Restriction enzyme

A restriction enzyme (also restriction endonuclease) is an enzyme that cuts double-stranded DNA. The position where the enzyme cuts the DNA is determined by a sequence of nucleotides that differs for each enzyme. Cuts can either result in blunt or sticky ends. Restriction enzymes allow the splicing of DNA from one source (or species) into another. Note that the DNA sequences recognised by these enzymes are palindromic-the sequence on one strand reads the same in the opposite direction on the complementary strand.

Original sequence

 GTCAGCCTGAGTCTGATGCTGAC
 CAGTCGGACTCAGACTACGACTG

Blunt ends

 GTCAGCCTG AGTCTGATGCTGAC
 CAGTCGGAC TCAGACTACGACTG

Sticky ends

 GTCAGCCTG AGTCTGATGCTGAC
 CAGTCGGACTCAGAC TACGACTG

Today, restriction enzymes are an essential tool (like scissors) in molecular biology.



All Wikipedia text is available under the terms of the GNU Free Documentation License

 
  Search Encyclopedia

Search over one million articles, find something about almost anything!
 
 
  
  Featured Article
Leo Ornstein

... the piano at age eight. From the period 1910 to 1925, Ornstein was the giant of modern music being performed in the states. Among his most notable pieces I Allegro ...