Encyclopedia >

  Article Content

Warning: include(/home/kidsnetau/encyclopedia/wiki/tero-dump/wikipedia/ka/) [function.include]: failed to open stream: No such file or directory in /home/kidsnetau/encyclopedia/wiki/tero-dump/wikipedia/index.php on line 210

Warning: include() [function.include]: Failed opening '/home/kidsnetau/encyclopedia/wiki/tero-dump/wikipedia/ka/' for inclusion (include_path='.:/usr/share/pear:/usr/share/php') in /home/kidsnetau/encyclopedia/wiki/tero-dump/wikipedia/index.php on line 210

All Wikipedia text is available under the terms of the GNU Free Documentation License

  Search Encyclopedia

Search over one million articles, find something about almost anything!
  Featured Article
Restriction enzyme

... in the opposite direction on the complementary strand. Original sequence GTCAGCCTGAGTCTGATGCTGAC CAGTCGGACTCAGACTACGACTG Blunt ends GTCAGCCTG AGTCTGATGCTGAC ...